01001000 01100101 01101100 01101100 01101111 01110111 00100001

[coder7]

01001000 01100101 01101100 01101100 01101111 01110111 00100001

I am new to this... but, hey all!

 

[Micro]

01001000 01100101 01101100 01101100 01101111 00100001 00100000 01010111 01100101 01101100
01100011 01101111 01101101 01100101 00100000 01110100 01101111 00100000 01111000 00110001
00110000 00100001

Hello! Welcome to x10!

 

[lambada]

01001010 01110101 01110011 01110100 00100000 01110010 01100101 01101101 01100101 01101101 01100010 01100101 01110010 00100000 01110100 01101000 01100001 01110100 00100000 01100010 01101001 01101110 01100001 01110010 01111001 00100000 01101001 01110011 00100000 01101110 01101111 01110100 00100000 01100001 00100000 01110011 01110101 01110000 01110000 01101111 01110010 01110100 01100101 01100100 00100000 01101100 01100001 01101110 01100111 01110101 01100001 01100111 01100101 00100000 01100110 01101111 01110010 00100000 01111001 01101111 01110101 01110010 00100000 01110111 01100101 01100010 01110011 01101001 01110100 01100101 00100000 01111001 01101111 01110101 00100000 01101110 01100101 01100101 01100100 00100000 01101001 01110100 00100000 01101001 01101110 00100000 01000101 01101110 01100111 01101100 01101001 01110011 01101000 00101100 00100000 01000110 01110010 01100101 01101110 01100011 01101000 00100000 01101111 01110010 00100000 01010011 01110000 01100001 01101110 01101001 01110011 01101000 00100000 00111010 01010000

 

[Derek]

01001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 0010000101001000 01100101 01101100 01101100 01101111 01110111 00100001

hello welcom to x10hosting.com hope you have a good time here if you got any questions feel free to pm me

 

[Alexis]

why are u writting in binary?

01110111 01101000 01111001 00100000 01100001 01110010 01100101 00100000 01110101 00100000 01110111 01110010 01101001 01110100 01110100 01101001 01101110 01100111 00100000 01101001 01101110 00100000 01100010 01101001 01101110 01100001 01110010 01111001 00111111

 

[benjamin]

zippidy

 

[the_king_dollars]

Welcome to X10Hosting!

 

[swirly]

01101001 00100000 01101000 01100001 01110100 01100101 00100000 01100010 01101001 01101110 01100001 01110010 01111001 00101110 00101110 00101110 01100010 01110101 01110100 00100000 01110111 01100101 01101100 01100011 01101111 01101101 01100101 00100000 01110100 01101111 00100000 01110100 01101000 01100101 00100000 01100110 01101111 01110010 01110101 01101101 01110011 00100001 00100000 01101100 01100101 01110100 00100000 01101101 01100101 00100000 01101011 01101110 01101111 01110111 00100000 01101001 01100110 00100000 01111001 01101111 01110101 00100000 01101110 01100101 01100101 01100100 00100000 01100001 01101110 01111001 00100000 01101000 01100101 01101100 01110000 00100001

 

[t2t2t]

000000000000000000000000000000000
010001011111010000010000001110010
010001010000010000010000010001010
011111011100010000010000010001010
010001010000010000010000010001000
010001011111011111011111001110010
000000000000000000000000000000000

 

[powersports]

Hey, new person...

Welcome

and

What does that code do/stand for? It doesn't seem to be in a simple BCD format or HEX format like I sorta know? What is it?

TTYL

 

[noerrorsfound]

Hey, new person...

Welcome

and

What does that code do/stand for? It doesn't seem to be in a simple BCD format or HEX format like I sorta know? What is it?

TTYL

I'm not the thread creator, but wanted to answer your question.

It's binary, except for post #9.

Helpful Google searches:
binary converter
binary translator

 

[Ferinos]

Bonjour, hello, Hola, gfuten tag order guten nacht, hiya au reviour.

 

[Cubeform]

Pfft... screw binary. Hex is what the cool kids use:

416C 736F 2C20 5745 4C43 4F4D 4520 746F 2078 3130 686F 7374 696E 6721

 

[lambada]

I disagree - Everything ends up as binary in a computer.

A little challenge - someone tell me what language this is
ATCGCGCGCGCATATATATATCGCGATATATCGCG
100 points to the first correct reply!

 

[Brandon]

Haha lambada, nobody can get that one....

 

[DaTaX]

A little challenge - someone tell me what language this is
ATCGCGCGCGCATATATATATCGCGATATATCGCG
100 points to the first correct reply!

That's DNA (at least its a string of the four kinds of bases that are found in DNA...). And by the way, I don't think there is a cooler coding language...

Now, here's to our new friend:

01010111 01100101 01101100 01100011 01101111 01101101 01100101 00100000 01110100 01101111 00100000 01111000 00110001 00110000 00100000 01101000 01101111 01110011 01110100 01101001 01101110 01100111 00100001

 

[noerrorsfound]

I disagree - Everything ends up as binary in a computer.

A little challenge - someone tell me what language this is
ATCGCGCGCGCATATATATATCGCGATATATCGCG
100 points to the first correct reply!

I'm not sure if you were talking about Cubeform's post or mine, but yes, his post is still "technically" binary. Although, if you wish to be that ____ (sorry, I couldn't remember the correct word to use) then the language you posted is also binary, and you now owe me 100 points for my correct answer. Actually, that's only if DaTaX didn't give the correct answer.

 

[Brandon]

It is DNA coding

 

[lambada]

Congrats DaTaX - 100 of my precious points are on their way. noerrors found can get 50 points for being technically right seeing as you are reading this on a computer based device